Basic Information
Description
The Drd2 gene encodes dopamine receptor D2. In this strain, Cre recombinase expression is under the control of Drd2 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Drd2 expressing cells.
-
Targeting Strategy
-
The P2A-NLS-Cre sequence was placed between the coding sequence of exon 3 and 3 ‘UTR of the Drd2 gene. The gene-modified mouse its genetic background was Sprague Dawley
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product
size (bp)Drd2 Cre primer 1 ACCTAGTCCAGTCTTTCCTTCGCCT 62 Mut: 407 Drd2 Cre primer 2 CGATCCCTGAACATGTCCATCAG 58 Drd2 Cre primer 1 ACCTAGTCCAGTCTTTCCTTCGCCT 62 Mut: 456
WT: 1551Drd2 Cre primer 3 AGATACCAGTCTCCCTGGCCCTAC 62 Polymerase: Kod-plus
-
References
-
1.Bunzow, J. R., Van Tol, H. H., Grandy, D. K., Albert, P., Salon, J., Christie, M., Machida, C.
A., Neve, K. A., Civelli, O. Cloning and expression of a rat D2 dopamine receptor
cDNA. Nature 336: 783-787, 1988. [PubMed: 2974511]
2. Basu, S., Nagy, J. A., Pal, S., Vasile, E., Eckelhoefer, I. A., Bliss, V. S., Manseau, E. J.,
Dasgupta, P. S., Dvorak, H. F., Mukhopadhyay, D. The neurotransmitter dopamine inhibits angiogenesis induced by vascular permeability factor/vascular endothelial growth factor. Nature Med. 7: 569-574, 2001. [PubMed: 11329058]
3.Duan, J., Wainwright, M. S., Comeron, J. M., Saitou, N., Sanders, A. R., Gelernter, J.,
Gejman, P. V. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect
mRNA stability and synthesis of the receptor. Hum. Molec. Genet. 12: 205-216, 2003. [PubMed: 12554675]
4. Balk, J.-H., Picetti, R., Salardi, A., Thirlet, G., Dierich, A., Depaulls, A., Le Meur, M.,
Borrelli, E. Parkinsonian-like locomotor impairment in mice lacking dopamine D2
receptors. Nature 377: 424-428, 1995. [PubMed: 7566118, related citations]