B-Oxt-iCre rats

Basic Information

Strain Name
SD-Oxttm1(iCre)/Bcgen
Stock Number
210501
Common Name
B-Oxt-iCre rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Oxt(oxytocin)
Species
SD Rat
Appearance
White

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm() Product size
(bp)
B-CR-025-Mut-F GGTGGCTGGACCAATGTGAAC 63 Mut:600
B-CR-025-WT-R GGCCGGGATTACCCCCTCAAC 59
B-CR-025-WT-F GGGCATCTGCTGTAGCCCGGG 62 WT: 646

Mut:1783

B-CR-025-WT-R GGCCGGGATTACCCCCTCAAC 59

References

Harshaw C, Leffel J K, Alberts J R. Oxytocin and the warm outer glow: Thermoregulatory deficits cause huddling abnormalities in oxytocin-deficient mouse pups[J]. Hormones and behavior, 2018, 98: 145-158.

Back to top