Basic Information
-
Targeting Strategy
-
The F2A-iCre sequence was placed between exon 23 and the 3 ‘UTR of the Pdgfrb gene. Genetically modified mice were on a C57BL/6 background
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Pdgfrb-primer 1 TCTTCCCGCTCTCAAGTTCTAGC 59 Mut: 595 Pdgfrb-primer 2 GCACACAGACAGGAGCATCTTC 59 Pdgfrb-primer 1 TCTTCCCGCTCTCAAGTTCTAGC 59 WT: 411
Mut: 1533Pdgfrb-primer 3 GTTCTGGGAGGCAGAAGGGAGATTC 61 Polymerase: Taq
-
References
-
1. Olson LE; Soriano P. 2011. PDGFRbeta Signaling Regulates Mural Cell Plasticity and
Inhibits Fat Development. Dev Cell 20(6):815-26. [PubMed: 21664579]
2. Chhabra A; Lechner AJ; Ueno M; Acharya A; Van Handel B; Wang Y; Iruela-Arispe ML;
Tallquist MD; Mikkola HK. 2012. Trophoblasts regulate the placental hematopoietic niche through PDGF-B signaling. Dev Cell 22(3):651-9. [PubMed: 22387002]
3. Hellstrom M; Kal n M; Lindahl P; Abramsson A; Betsholtz C. 1999. Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse. Development 126(14):3047-55. [PubMed: 10375497]
4. Klinghoffer RA; Mueting-Nelsen PF; Faerman A; Shani M; Soriano P. 2001. The two PDGF receptors maintain conserved signaling in vivo despite divergent embryological functions. Mol Cell 7(2):343-54. [PubMed: 11239463]
5. Lindahl P; Hellstrom M; Kalen M; Karlsson L; Pekny M; Pekna M; Soriano P; Betsholtz C.
1998. Paracrine PDGF-B/PDGF-Rbeta signaling controls mesangial cell development in kidney glomeruli. Development 125(17):3313-22. [PubMed: 9693135]