Basic Information
In this strain, Cre recombinase expression is under the control of Prrx1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Prrx1 expressing cells.
-
Targeting Strategy
-
An F2A-iCre sequence cassette was placed between the coding sequence of exon 1 and 5’UTR of the Prrx1 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Prrx1 iCre primer 1 AGCGTTTGGTGTTGATTCGAGC 60 WT: 267 Prrx1 iCre primer 2 AGTCCCGGTGACTCCAGCAG 62 Prrx1 iCre primer 1 AGCGTTTGGTGTTGATTCGAGC 62 Mut: 108 Prrx1 iCre primer 3 TGGTGCACAGTCAGCAGGTTG 61 Polymerase: Taq
-
References
-
1. Durland JL; Sferlazzo M; Logan M; Burke AC. 2008. Visualizing the lateral somitic frontier
in the Prx1Cre transgenic mouse. J Anat 212(5):590-602. [PubMed: 18430087] [MGI Ref ID J:209265]
2. Seo HS; Serra R. 2007. Deletion of Tgfbr2 in Prx1-cre expressing mesenchyme results in
defects in development of the long bones and joints. Dev Biol 310(2):304-16. [PubMed:
17822689] [MGI Ref ID J:128010] -
Publications