Basic Information

Strain Name
C57BL/6-Prrx1 tm1(iCre) /Bcgen
Stock Number
110130
Common Name
B-Prrx1-iCre mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Prrx1 (paired related homeobox 1); K-2; Pmx; Pmx1; Prx1; mHox; AA755424; AI385634; AI843499; A230024N07Rik
Species
C57BL/6N
Appearance
Black
Genotypes
Prrx1 iCre (wt/mut)
Development
In this strain, Cre recombinase expression is under the control of Prrx1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Prrx1 expressing cells.
NCBI Gene ID

Targeting Strategy

An F2A-iCre sequence cassette was placed between the coding sequence of exon 1 and 5’UTR of the Prrx1 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Prrx1 iCre primer 1 AGCGTTTGGTGTTGATTCGAGC 60 WT: 267
Prrx1 iCre primer 2 AGTCCCGGTGACTCCAGCAG 62
Prrx1 iCre primer 1 AGCGTTTGGTGTTGATTCGAGC 62 Mut: 108
Prrx1 iCre primer 3 TGGTGCACAGTCAGCAGGTTG 61

Polymerase: Taq

 

 

 

 

 

References

1. Durland JL; Sferlazzo M; Logan M; Burke AC. 2008. Visualizing the lateral somitic frontier
in the Prx1Cre transgenic mouse. J Anat 212(5):590-602. [PubMed: 18430087] [MGI Ref ID J:209265]
2. Seo HS; Serra R. 2007. Deletion of Tgfbr2 in Prx1-cre expressing mesenchyme results in
defects in development of the long bones and joints. Dev Biol 310(2):304-16. [PubMed:
17822689] [MGI Ref ID J:128010]