B-Tcf21-iCreERT2 mice

Basic Information

Description

This Tcf-iCre/ERT2 model is an efficient tool to study various gene functions when crossed with mice with different loxP site-flanked genes of interest, especially in studies of natural mesenchyme-derived tissue.

Details

 

 Genotyping PCR Primer

Primer	Sequence (5’-3’)	Tm (℃)	Product Size (bp)
Primer-WT-F	GACTGCCAGATCCCACCTCAAAC	62	WT:415bp
Primer-WT-R	GGAGAAGGCCTTGCTCAGCAC	63
Primer-WT-F	GACTGCCAGATCCCACCTCAAAC	62	Mut:265bp
Primer–Mut-R	GCACACAGACAGGAGCATCTTC	59

 PCR Reaction System

Reaction Component	Volume(µL)	Final Concentration
ddH2O	14	–
10×Taq buffer	2	1×
10 mM dNTPs	0.5	250 mM each
10 mM Primer-F	0.5	0.25 mM
10 mM Primer-R	0.5	0.25 mM
2.5 U/mL Taq DNA Polymerase Polymerase	0.5	0.0625 U/mL
100-200   ng/mL Template DNA	2	10-20 ng/mL

PCR Steps

Step	Temp.	Time	Cycles
1	95℃	5 min	1
2	95 ℃	30 s	30
3	61 ℃	30 s
4	72 ℃	1 kb / min
5	72 ℃	10 min	1
6	4℃	hold	1

Determination of Genotypes

Identification of Genotypes According to PCR Results

Primer-WT-F/Primer-WT-R		Primer-WT-F /Primer-Mut-R	Genotype
Mutation	Wild Type	Mutation
N*	N	Y	Mut/Mut
N*	Y	Y	Mut/+
N	Y	N	+/+

N*: PCR product was too long to detect Mut/Mut: representing homozygous
N: No expected PCR product detected Mut/+: hemizygous
Y: Expected PCR product detected. +/+: wild type allele

Agarose Gel Electrophoresis

Gene Editing Results

Number	Strain Number	Genotype
1	1SY2-009	Mut/ +
2	1SY2-011	Mut/ +
3	1SY2-012	Mut/ +
4	1SY2-014	Mut/ +
5	1SY2-015	Mut/ +
6	1SY2-019	Mut/+
7	1SY2-020	Mut/ +
8	1SY2-022	Mut/ +
9	1SY2-026	Mut/ +
10	1SY2-031	Mut/ +
11	1SY2-032	Mut/ +

 

References

1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H; Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012. Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]
7. 7. Wang F, Meng M, Mo B, et al. Crosstalks between mTORC1 and mTORC2 variagate cytokine signaling to control NK maturation and effector function[J]. Nature communications, 2018, 9(1): 4874