B-Tcf21-iCreERT2 mice

Basic Information

Description

In human, TCF21 encodes a transcription factor of the basic helix-loop-helix family. The TCF21 product is mesoderm specific, and expressed in embryonic epicardium, mesenchyme-derived tissues of lung, gut, gonad, and both mesenchymal and glomerular epithelial cells in the kidney. Two transcript variants encoding the same protein have been found for this gene.

This Tcf-iCre/ERT2 model is an efficient tool to study various gene functions when crossed with mice with different loxP site-flanked genes of interest, especially in studies of natural mesenchyme-derived tissue.

Targeting strategy

Details

Genotyping Strategy

 Genotyping PCR Primer

Primer	Sequence (5’-3’)	Tm (℃)	Product Size (bp)
Primer-WT-F	GACTGCCAGATCCCACCTCAAAC	62	WT:415bp
Primer-WT-R	GGAGAAGGCCTTGCTCAGCAC	63
Primer-WT-F	GACTGCCAGATCCCACCTCAAAC	62	Mut:265bp
Primer–Mut-R	GCACACAGACAGGAGCATCTTC	59

 PCR Reaction System

Reaction Component	Volume(µL)	Final Concentration
ddH2O	14	–
10×Taq buffer	2	1×
10 mM dNTPs	0.5	250 mM each
10 mM Primer-F	0.5	0.25 mM
10 mM Primer-R	0.5	0.25 mM
2.5 U/mL Taq DNA Polymerase Polymerase	0.5	0.0625 U/mL
100-200   ng/mL Template DNA	2	10-20 ng/mL

PCR Steps

Step	Temp.	Time	Cycles
1	95℃	5 min	1
2	95 ℃	30 s	30
3	61 ℃	30 s
4	72 ℃	1 kb / min
5	72 ℃	10 min	1
6	4℃	hold	1

Determination of Genotypes

Identification of Genotypes According to PCR Results

Primer-WT-F/Primer-WT-R		Primer-WT-F /Primer-Mut-R	Genotype
Mutation	Wild Type	Mutation
N*	N	Y	Mut/Mut
N*	Y	Y	Mut/+
N	Y	N	+/+

N*: PCR product was too long to detect Mut/Mut: representing homozygous
N: No expected PCR product detected Mut/+: hemizygous
Y: Expected PCR product detected. +/+: wild type allele

Agarose Gel Electrophoresis

Gene Editing Results

Number	Strain Number	Genotype
1	1SY2-009	Mut/ +
2	1SY2-011	Mut/ +
3	1SY2-012	Mut/ +
4	1SY2-014	Mut/ +
5	1SY2-015	Mut/ +
6	1SY2-019	Mut/+
7	1SY2-020	Mut/ +
8	1SY2-022	Mut/ +
9	1SY2-026	Mut/ +
10	1SY2-031	Mut/ +
11	1SY2-032	Mut/ +

 

References

1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H; Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012. Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]
7. 7. Wang F, Meng M, Mo B, et al. Crosstalks between mTORC1 and mTORC2 variagate cytokine signaling to control NK maturation and effector function[J]. Nature communications, 2018, 9(1): 4874