Basic Information
Description
In human, TCF21 encodes a transcription factor of the basic helix-loop-helix family. The TCF21 product is mesoderm specific, and expressed in embryonic epicardium, mesenchyme-derived tissues of lung, gut, gonad, and both mesenchymal and glomerular epithelial cells in the kidney. Two transcript variants encoding the same protein have been found for this gene.
This Tcf-iCre/ERT2 model is an efficient tool to study various gene functions when crossed with mice with different loxP site-flanked genes of interest, especially in studies of natural mesenchyme-derived tissue.
-
Targeting strategy
-
Details
-
Genotyping PCR Primer
Primer Sequence (5’-3’) Tm (℃) Product Size (bp) Primer-WT-F GACTGCCAGATCCCACCTCAAAC 62 WT:415bp Primer-WT-R GGAGAAGGCCTTGCTCAGCAC 63 Primer-WT-F GACTGCCAGATCCCACCTCAAAC 62 Mut:265bp Primer–Mut-R GCACACAGACAGGAGCATCTTC 59 PCR Reaction System
Reaction Component Volume(µL) Final Concentration ddH2O 14 – 10×Taq buffer 2 1× 10 mM dNTPs 0.5 250 mM each 10 mM Primer-F 0.5 0.25 mM 10 mM Primer-R 0.5 0.25 mM 2.5 U/mL Taq DNA Polymerase Polymerase 0.5 0.0625 U/mL 100-200 ng/mL Template DNA 2 10-20 ng/mL PCR Steps
Step Temp. Time Cycles 1 95℃ 5 min 1 2 95 ℃ 30 s 30 3 61 ℃ 30 s 4 72 ℃ 1 kb / min 5 72 ℃ 10 min 1 6 4℃ hold 1 Determination of Genotypes
Identification of Genotypes According to PCR Results
Primer-WT-F/Primer-WT-R Primer-WT-F /Primer-Mut-R Genotype Mutation Wild Type Mutation N* N Y Mut/Mut N* Y Y Mut/+ N Y N +/+ N*: PCR product was too long to detect Mut/Mut: representing homozygous
N: No expected PCR product detected Mut/+: hemizygous
Y: Expected PCR product detected. +/+: wild type alleleAgarose Gel Electrophoresis
Gene Editing Results
Number Strain Number Genotype 1 1SY2-009 Mut/ + 2 1SY2-011 Mut/ + 3 1SY2-012 Mut/ + 4 1SY2-014 Mut/ + 5 1SY2-015 Mut/ + 6 1SY2-019 Mut/+ 7 1SY2-020 Mut/ + 8 1SY2-022 Mut/ + 9 1SY2-026 Mut/ + 10 1SY2-031 Mut/ + 11 1SY2-032 Mut/ + -
References
-
- Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H; Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
- Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
- Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
- Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
- Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012. Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
- Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]
- 7. Wang F, Meng M, Mo B, et al. Crosstalks between mTORC1 and mTORC2 variagate cytokine signaling to control NK maturation and effector function[J]. Nature communications, 2018, 9(1): 4874
