Basic Information
In this strain, Cre recombinase expression is under the control of Ucp1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Ucp1 expressing cells.
-
Targeting Strategy
-
An IRES-iCre sequence cassette was placed between the coding sequence of exon 6 and 3’UTR of the Ucp1 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at least 300 bp downstream of 3’UTR. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product
size (bp)Ucp1 iCre primer 1 GTCCTGGAACGTCATCATGTTTGTG 60 WT:187 Ucp1 iCre primer 2 AGTCAACGGAGCTGTTCATTTGATTTC 60 Ucp1 iCre primer 1 GTCCTGGAACGTCATCATGTTTGTG 60 Mut:308 Ucp1 iCre primer 3 GTCCTGGAACGTCATCATGTTTGTG 60 Polymerase: Taq
-
References
-
1. Dlaskova A; Clarke KJ; Porter RK. 2010. The role of UCP 1 in production of reactive
oxygen species by mitochondria isolated from brown adipose tissue. Biochim Biophys Acta
1797(8):1470-6. [PubMed: 20416274]2. Fedorenko A; Lishko PV; Kirichok Y. 2012. Mechanism of Fatty-Acid-Dependent UCP1
Uncoupling in Brown Fat Mitochondria. Cell 151(2):400-13. [PubMed: 23063128]
3. Galmozzi A; Sonne SB; Altshuler-Keylin S; Hasegawa Y; Shinoda K; Luijten IH; Chang JW; Sharp LZ; Cravatt BF; Saez E; Kajimura S. 2014. ThermoMouse: an in vivo model to identify modulators of UCP1 expression in brown adipose tissue. Cell Rep 9(5):1584-93. [PubMed: 25466254]
4. Golozoubova V; Cannon B; Nedergaard J. 2006. UCP1 is essential for adaptive adrenergic nonshivering thermogenesis. Am J Physiol Endocrinol Metab 291(2): E350-7. [PubMed: 16595854]
5. Inokuma K; Ogura-Okamatsu Y; Toda C; Kimura K; Yamashita H; Saito M. 2005.
Uncoupling protein 1 is necessary for norepinephrine-induced glucose utilization in brown adipose tissue. Diabetes 54(5):1385-91. [PubMed: 15855324]
6. Oelkrug R; Kutschke M; Meyer CW; Heldmaier G; Jastroch M. 2010. Uncoupling protein 1 decreases superoxide production in brown adipose tissue mitochondria. J Biol Chem 285(29):21961-8. [PubMed: 20466728]
7. Shabalina IG; Backlund EC; Bar-Tana J; Cannon B; Nedergaard J. 2008. Within brown-fat cells, UCP1-mediated fatty acid-induced uncoupling is independent of fatty acid metabolism. Biochim Biophys Acta 1777(7-8):642-50. [PubMed: 18489899]8.Wang T, Zhao C, Zhang J, Li S, Zhang Y, Gong Y, Zhou Y, Yan L, Zhang S, Zhang Z, Hu H, Liu A, Bai X, Zou Z. Whitening of brown adipose tissue inhibits osteogenic differentiation via secretion of S100A8/A9. iScience. 2024 Jan 11;27(2):108857. doi: 10.1016/j.isci.2024.108857. PMID: 38303710; PMCID: PMC10830855.
-
Publication
-
Whitening of brown adipose tissue inhibits osteogenic differentiation via secretion of S100A8/A9