Basic Information
-
Targeting Strategy
-
An IRES-iCre sequence cassette was placed between the coding sequence of exon 6 and 3’UTR of the Ucp1 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at least 300 bp downstream of 3’UTR. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product
size (bp)Ucp1 iCre primer 1 GTCCTGGAACGTCATCATGTTTGTG 60 WT:187 Ucp1 iCre primer 2 AGTCAACGGAGCTGTTCATTTGATTTC 60 Ucp1 iCre primer 1 GTCCTGGAACGTCATCATGTTTGTG 60 Mut:308 Ucp1 iCre primer 3 GTCCTGGAACGTCATCATGTTTGTG 60 Polymerase: Taq
-
References
-
1. Dlaskova A; Clarke KJ; Porter RK. 2010. The role of UCP 1 in production of reactive
oxygen species by mitochondria isolated from brown adipose tissue. Biochim Biophys Acta
1797(8):1470-6. [PubMed: 20416274]
2. Fedorenko A; Lishko PV; Kirichok Y. 2012. Mechanism of Fatty-Acid-Dependent UCP1
Uncoupling in Brown Fat Mitochondria. Cell 151(2):400-13. [PubMed: 23063128]
3. Galmozzi A; Sonne SB; Altshuler-Keylin S; Hasegawa Y; Shinoda K; Luijten IH; Chang JW; Sharp LZ; Cravatt BF; Saez E; Kajimura S. 2014. ThermoMouse: an in vivo model to identify modulators of UCP1 expression in brown adipose tissue. Cell Rep 9(5):1584-93. [PubMed: 25466254]
4. Golozoubova V; Cannon B; Nedergaard J. 2006. UCP1 is essential for adaptive adrenergic nonshivering thermogenesis. Am J Physiol Endocrinol Metab 291(2): E350-7. [PubMed: 16595854]
5. Inokuma K; Ogura-Okamatsu Y; Toda C; Kimura K; Yamashita H; Saito M. 2005.
Uncoupling protein 1 is necessary for norepinephrine-induced glucose utilization in brown adipose tissue. Diabetes 54(5):1385-91. [PubMed: 15855324]
6. Oelkrug R; Kutschke M; Meyer CW; Heldmaier G; Jastroch M. 2010. Uncoupling protein 1 decreases superoxide production in brown adipose tissue mitochondria. J Biol Chem 285(29):21961-8. [PubMed: 20466728]
7. Shabalina IG; Backlund EC; Bar-Tana J; Cannon B; Nedergaard J. 2008. Within brown-fat cells, UCP1-mediated fatty acid-induced uncoupling is independent of fatty acid metabolism. Biochim Biophys Acta 1777(7-8):642-50. [PubMed: 18489899]