Basic Information
Strain Name
SD-Ldlrtm1/Bcgen
Stock Number
210506
Common Name
B-Ldlr KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Ldlr (low density lipoprotein receptor)
Species
Sprague Dawley
Appearance
White
Genotypes
LdlrKO (mut/mut)
Development
The LdlrKO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses a 2 bp deletion within Exon 1 on chromosome 8. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
Description
The Low Density Lipoprotein (LDL) Receptor is a cell-surface receptor presented in clathrin-coated pits that mediates the endocytosis of LDL, the major cholesterol-carrying lipoprotein of plasma. Loss of Ldlr function leads to accumulation of excess LDL in the blood, leading to elevated serum cholesterol, especially when fed a high fat diet, which makes Ldlr knockout rat a good model for studying atherosclerosis.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm (℃)
Product size (bp) LdlrKO primer 1 GTAGTCAGTCACCAGTTGACCCAGT 62 Mut: 875 WT: 877
LdlrKO primer 2 CAGAGGCACAACTATGAAGCTGACC 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Afek A; Keren G; Harats D; George J. 2001. Whole body hyperthermia accelerates atherogenesis in low-density lipoprotein receptor deficient mice. Exp Mol Pathol 71(1):63-72. [PubMed: 11502098]
- Adachi H; Kondo T; Koh GY; Nagy A; Oike Y; Araki E. 2011. Angptl4 deficiency decreases serum triglyceride levels in low-density lipoprotein receptor knockout mice and streptozotocin-induced diabetic mice. Biochem Biophys Res Commun 409(2):177-80. [PubMed: 21549101]
- Babaev VR; Ishiguro H; Ding L; Yancey PG; Dove DE; Kovacs WJ; Semenkovich CF; Fazio S; Linton MF. 2007. Macrophage expression of peroxisome proliferator-activated receptor-alpha reduces atherosclerosis in low-density lipoprotein receptor-deficient mice. Circulation 116(12):1404-12. [PubMed: 17724261]