Basic Information
Strain Name
SD-Rag2tm1Il2rgtm1/Bcgen
Stock Number
210512
Common Name
B-Rag2/IL2rg KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Rag2 (recombination activating gene 2); Il2rg (interleukin 2 receptor, gamma)
Species
Sprague Dawley
Appearance
White
Genotypes
Rag2KO (mut/mut); Il2rgKO(mut/mut)
NCBI Gene ID
Description
The B-Rag2-IL2rg knockout rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses Rag2 and IL2rg gene deletion. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
-
Targeting Strategy
-
-
Details
-
Genotyping Information
Primer Sequence(5’-3’) Tm (℃)
Product size (bp) Rag2KO primer 1 CCTCGGATTCTCAAAGCAAGGG 62 Mut:881 WT:1002
Rag2KO primer 2 CAGGACGTATGTTACTGGCAAGTG 62 Primer Sequence (5’-3’) Tm (℃)
Product size (bp) IL2rgKO primer 1 GCTCCAAGGTCCTCATGTCCAG 62 Mut:915 WT:929
IL2rgKO primer 2 ATCTTCGCCTTTCTGCCCATGAC 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Corneo, B., et al., Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome. Blood, 2001. 97(9): p. 2772-6. [PubMed: 11313270]
- Shinkai, Y., et al., RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell, 1992. 68(5): p. 855-67. [PubMed: 1547487]
- Rideout, W.M., 3rd, et al., Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell, 2002. 109(1): p. 17-27. [MGI Ref ID J:11955443]
- Ohbo, K., et al., Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor gamma chain. Blood, 1996. 87(3): p. 956-67. [PubMed: 8562967]
- Mashimo, T., et al., Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One, 2010. 5(1): p. e8870. [PubMed: 20111598]
- Mashimo, T., et al., Generation and characterization of severe combined immunodeficiency rats. Cell Rep, 2012. 2(3): p. 685-94. [PubMed: 22981234]