Basic Information
Strain Name
SD-Rag2tm1Il2rgtm1/Bcgen
Stock Number
210512
Common Name
B-Rag2/IL2rg KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Rag2 (recombination activating gene 2); Il2rg (interleukin 2 receptor, gamma)
Species
Sprague Dawley
Appearance
White
Genotypes
Rag2KO (mut/mut); Il2rgKO(mut/mut)
Development
The B-Rag2-IL2rg knockout rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses Rag2 and IL2rg gene deletion. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
Description
The recombinant-activating gene 2 (Rag2) plays an important role in the rearrangement and recombination of the genes of immunoglobulin and T cell receptor molecules during the initiation of V(D)J recombination. Loss of Rag2 protein leads to no mature T and B cells, the critical components of the adaptive immune system.
Il2rg is known as the interleukin receptor common gamma chain, which is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21. Mutations in this gene cause X-linked severe combined immunodeficiency.
-
Targeting Strategy
-
-
Details
-
Genotyping Information
Primer Sequence(5’-3’) Tm (℃)
Product size (bp) Rag2KO primer 1 CCTCGGATTCTCAAAGCAAGGG 62 Mut:881 WT:1002
Rag2KO primer 2 CAGGACGTATGTTACTGGCAAGTG 62 Primer Sequence (5’-3’) Tm (℃)
Product size (bp) IL2rgKO primer 1 GCTCCAAGGTCCTCATGTCCAG 62 Mut:915 WT:929
IL2rgKO primer 2 ATCTTCGCCTTTCTGCCCATGAC 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Corneo, B., et al., Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome. Blood, 2001. 97(9): p. 2772-6. [PubMed: 11313270]
- Shinkai, Y., et al., RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell, 1992. 68(5): p. 855-67. [PubMed: 1547487]
- Rideout, W.M., 3rd, et al., Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell, 2002. 109(1): p. 17-27. [MGI Ref ID J:11955443]
- Ohbo, K., et al., Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor gamma chain. Blood, 1996. 87(3): p. 956-67. [PubMed: 8562967]
- Mashimo, T., et al., Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One, 2010. 5(1): p. e8870. [PubMed: 20111598]
- Mashimo, T., et al., Generation and characterization of severe combined immunodeficiency rats. Cell Rep, 2012. 2(3): p. 685-94. [PubMed: 22981234]