Basic Information
Strain Name
SD-Rag2tm1/Bcgen
Stock Number
210511
Common Name
B-Rag2 KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Rag2 (recombination activating gene 2)
Species
Sprague Dawley
Appearance
White
Genotypes
Rag2KO (mut/mut)
Development
The Rag2KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses a 121 bp deletion within Exon 3 on chromosome 3. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
Description
The recombinant-activating gene 2 (Rag2) plays an important role in the rearrangement and recombination of the genes of immunoglobulin and T cell receptor molecules during the initiation of V(D)J recombination. Loss of Rag2 protein leads to no mature T and B cells, the critical components of the adaptive immune system.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm (℃)
Product size (bp) Rag2KO primer 1 CCTCGGATTCTCAAAGCAAGGG 62 Mut: 881 WT: 1002
Rag2KO primer 2 CAGGACGTATGTTACTGGCAAGTG 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Corneo, B., et al., Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome. Blood, 2001. 97(9): p. 2772-6. [PubMed: 11313270]
- Shinkai, Y., et al., RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell, 1992. 68(5): p. 855-67. [PubMed: 1547487]
- Rideout, W.M., 3rd, et al., Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell, 2002. 109(1): p. 17-27. [MGI Ref ID J:11955443]