Basic Information
Strain Name
SD-Tp53tm1/Bcgen
Stock Number
210507
Common Name
B-p53 KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Tp53 (tumor protein p53)
Species
Sprague Dawley
Appearance
White
Genotypes
Tp53KO (mut/mut); Tp53KO (wt/mut)
Development
The Tp53KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses a 12 bp deletion and 2 bp insertion within Exon 2 on chromosome 10. This strain was maintained by mating heterozygous females with homozygous males on a Sprague-Dawley genetic background.
Description
Tumor suppressor p53 encoded by Tp53 gene contributes to cell cycle arrest, apoptosis, senescence, DNA repair and metabolism. Homozygous Tp53 null rats display onset of spontaneous tumors at 4~6 months of age. Tp53tm1/Bcgen rat is a useful model for studying tumor formation, screening of in vivo carcinogenicity, and examining the efficacy of therapeutic agents.
-
Targeting Strategy
-
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm (℃)
Product size (bp) Tp53KO primer 1 TGGCCGACTTCTTGGTTACTTGT 62 Mut: 1078 WT: 1088
Tp53KO primer 2 CTCTGAGGCATAGTCAAAGTCCAC 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Hursting, S.D., et al., Chemoprevention of spontaneous tumorigenesis in p53-knockout mice. Cancer Res, 1995.55(18): p. 3949-53. [PubMed: 7664260]
- van Boxtel, R., et al., Homozygous and heterozygous p53 knockout rats develop metastasizing sarcomas with high frequency. Am J Pathol, 2011. 179(4): p.1616-22. [PubMed: 21854749]
- Hermsen, R., et al., Lack of major genome instability in tumors of p53 null rats. PLoS One, 2015. 10(3): p.e0122066. [PubMed: 25811670]