Basic Information
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product
size (bp)Tgfb1 CKO primer 1 AGGCTAACTCCCAGTGAACAGC 60 WT: 182
Mut: 238Tgfb1 CKO primer 2 CCAGTAGCGGCCAAACTTCTC 59 Polymerase: Taq
-
References
-
1. Shull MM; Ormsby I; Kier AB; Pawlowski S; Diebold RJ; Yin M; Allen R; Sidman C; Proetzel G; Calvin D; Annunziata N; Doetschman T. 1992. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359(6397):693-9. [PMID: 1436033];
2. Boivin GP; O'Toole BA; Orsmby IE; Diebold RJ; Eis MJ; Doetschman T; Kier AB. 1995. Onset and progression of pathological lesions in transforming growth factor-beta 1-deficient mice. Am J Pathol 146(1):276-88. [PMID: 7856734];
3. Engle SJ; Ormsby I; Pawlowski S; Boivin GP; Croft J; Balish E; Doetschman T. 2002.
Elimination of Colon Cancer in Germ-free Transforming Growth Factor Beta 1-deficient Mice. Cancer Res 62(22):6362-6. [PMID: 12438215]