Basic Information

Strain Name
C57BL/6-Tgfb1 tm1 /Bcgen
Stock Number
110164
Common Name
B-Tgfb1 cKO mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Tgfb1; TGF-Beta1 (transforming growth factor, beta 1)
Species
C57BL/6J
Appearance
Black
Genotypes
Tgfb1 CKO (mut/mut)
Development
A designed targeting vector containing 5’-homologous arm, loxP-Exon2- frt-Neo-frt-loxP, 3’-homologous arm, and DTA selection marker was introduced into C57BL/6 ES cells, replacing corresponding Tgfb1 exon 2 locus. The resulting chimeric animals were crossed to C57BL/6 mice to establish the colony.
NCBI Gene ID

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
Tgfb1 CKO primer 1 AGGCTAACTCCCAGTGAACAGC 60 WT: 182
Mut: 238
Tgfb1 CKO primer 2 CCAGTAGCGGCCAAACTTCTC 59

Polymerase: Taq

 

 

References

1. Shull MM; Ormsby I; Kier AB; Pawlowski S; Diebold RJ; Yin M; Allen R; Sidman C; Proetzel G; Calvin D; Annunziata N; Doetschman T. 1992. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359(6397):693-9. [PMID: 1436033];
2. Boivin GP; O'Toole BA; Orsmby IE; Diebold RJ; Eis MJ; Doetschman T; Kier AB. 1995. Onset and progression of pathological lesions in transforming growth factor-beta 1-deficient mice. Am J Pathol 146(1):276-88. [PMID: 7856734];
3. Engle SJ; Ormsby I; Pawlowski S; Boivin GP; Croft J; Balish E; Doetschman T. 2002.
Elimination of Colon Cancer in Germ-free Transforming Growth Factor Beta 1-deficient Mice. Cancer Res 62(22):6362-6. [PMID: 12438215]