B-Apoa4 KO rats

Basic Information

Description

The Apoa4 KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain. This model possesses an 8 bp deletion within Exon 2 on chromosome 8 causing a protein frame shift. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.

Targeting strategy

Genotyping information

Primer	Sequence (5’-3’)	Tm (℃	Product size (bp)
Apoa4KO primer 1	GACGCTAGGAAACATCCAGTGTAGC	62	Mut: 694 WT: 702
Apoa4KO primer 2	CCATTTACCAAACGCTAGCACATGC	62

Polymerase: Taq

The fragments need to be verified by sequencing.

References

1. Whited KL; Tso P; Raybould HE. 2007. Involvement of apolipoprotein A-IV and cholecystokinin1 receptors in exogenous peptide YY3 36-induced stimulation of intestinal feedback. Endocrinology 148(10):4695-703. [PubMed: 17641001]
2. Li X; Xu M; Wang F; Kohan AB; Haas MK; Yang Q; Lou D; Obici S; Davidson WS; Tso P. 2014. Apolipoprotein A-IV reduces hepatic gluconeogenesis through nuclear receptor NR1D1. J Biol Chem 289(4):2396-404. [PubMed: 24311788] [MGI Ref ID J:209530]
3. Yoshimichi G; Lo CC; Tamashiro KL; Ma L; Lee DM; Begg DP; Liu M; Sakai RR; Woods SC; Yoshimatsu H; Tso P. 2012. Effect of peripheral administration of cholecystokinin on food intake in apolipoprotein AIV knockout mice. Am J Physiol Gastrointest Liver Physiol 302(11):G1336-42. [PubMed: 22461023] [MGI Ref ID J:191161]