Basic Information

Strain Name
SD-Apoe tm1 /Bcgen
Stock Number
210508
Common Name
B-Apoe KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Apoe (apolipoprotein E)
Background
Sprague Dawley
Appearance
White
Genotypes
Apoe KO (mut/mut)
NCBI Gene ID

Description

The Apoe KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain. This model possesses a 13 bp deletion within Exon 3 on chromosome 1. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.

Publication

A longitudinal 18F-fluorodeoxyglucose (18F-FDG) and 18F-sodium fluoride (18F-NaF) positron emission tomography/computed tomography (PET/CT) study in apolipoprotein E (ApoE) knockout rats fed with a Western diet

Genotyping

Genotyping Information

 

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
Apoe KO primer 1 GTTGGTCCCATTGCTGACAG 62 Mut: 735
WT: 748
Apoe KO primer 2 CAGATAGGAGGAACCCCTGGAT 62

Polymerase: Taq
The fragments need to be verified by sequencing.

Protein Expression

Homozygous Apoetm1/Bcgen rat showed loss of ApoE protein in liver and spleen via western blotting.

Serum Cholesterol

Homozygous Apoetm1/Bcgen rats exhibit significantly elevated serum cholesterol levels at the age of 2 months.

References

  1. Ishibashi S; Herz J; Maeda N; Goldstein JL; Brown MS. 1994. The two-receptor model of
    lipoprotein clearance: tests of the hypothesis in knockout mice lacking the low density
    lipoprotein receptor, apolipoprotein E, or both proteins. Proc Natl Acad Sci U S A
    91(10):4431-5. [PubMed: 8183926]
  2. Miura Y; Chiba T; Tomita I; Koizumi H; Miura S; Umegaki K; Hara Y; Ikeda M; Tomita T. 2001. Tea catechins prevent the development of atherosclerosis in apoprotein E-deficient mice. J Nutr 131(1):27-32[PubMed: 11208934]
  3. Ekuni, D., et al., Occlusal disharmony accelerates the initiation of atherosclerosis in apoE knockout rats. Lipids Health Dis, 2014. 13: p. 144. [PubMed: 25189624]
Back to top