Basic Information
Strain Name
SD-Pink1tm1Bcgen/Bcgen
Stock Number
210509
Common Name
B-Pink1 KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Pink1 (PTEN induced putative kinase 1)
Background
Sprague Dawley
Appearance
White
Genotypes
Pink1 KO (mut/mut)
NCBI Gene ID
Description
Pink1 KO rats were developed using CRISPR/Cas9 technology in the Sprague-Dawley strain. Two sgRNAs were designed to generate a ~6.5kb chromosomal deletion spanning exons 2-4 of the Pink1 locus in the rat genome. As a result, the majority of the coding region of Pink1 is knocked out. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm (℃)
Product size (bp) Pink1KO primer 1 TACTGACTTCTCGACCCAACTT 62 WT: 7109 Mut: ~400
Pink1KO primer 2 GAACTTGTGGCCGTTTACGTCG 62 Polymerase: KOD-plus
-
References
-
- Gandhi, S., Wood-Kaczmar, A., Yao, Z., Plun-Favreau, H., Deas, E., Klupsch, K., Downward, J., Latchman, D. S., Tabrizi, S. J., Wood, N. W., Duchen, M. R., Abramov, A. Y. 2009. PINK1-associated Parkinson’s disease is caused by neuronal vulnerability to calcium-induced cell death. Molec. Cell 33: 627-638. [PubMed: 19285945]
- Tang, B., Xiong, H., Sun, P., Zhang, Y., Wang, D., Hu, Z., Zhu, Z., Ma, H., Pan, Q., Xia, J., Xia, K., Zhang, Z. 2006. Association of PINK1 and DJ-1 confers digenic inheritance of early-onset Parkinson’s disease. Hum. Molec. Genet. 15: 1816-1825. [PubMed: 16632486]
- Valente, E. M., Abou-Sleiman, P. M., Caputo, V., Muqit, M. M. K., Harvey, K., Gispert, S., Ali, Z., Del Turco, D., Bentivoglio, A. R., Healy, D. G., Albanese, A., Nussbaum, R., and 10 others. 2004. Hereditary early-onset Parkinson’s disease caused by mutations in PINK1. Science 304: 1158-1160. [PubMed: 15087508]
- Yang, Y., Gehrke, S., Imai, Y., Huang, Z., Ouyang, Y., Wang, J.-W., Yang, L., Beal, M. F., Vogel, H., Lu, B. 2006. Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by parkin. Proc. Nat. Acad. Sci. 103: 10793-10798. [PubMed: 16818890]